shctrl constructs  (OriGene)

Journal: bioRxiv

Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP

doi: 10.1101/2025.07.16.665171

Figure Lengend Snippet: a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

Article Snippet: Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882).

Techniques: Immunofluorescence, Expressing, Sequencing, Plasmid Preparation, Selection

Journal: Cancers

Article Title: Dual Role of Integrin Alpha-6 in Glioblastoma: Supporting Stemness in Proneural Stem-Like Cells While Inducing Radioresistance in Mesenchymal Stem-Like Cells

doi: 10.3390/cancers13123055

Figure Lengend Snippet: Silencing of integrin a6 in MES-GSCs does not have an impact on stemness and self-renewal. ( A , C ) Representative Western blot of the lentiviral-based shRNA silencing of ITGA6 in PN-GIC2 ( A ) and MES-GSCs ( C ). The values indicated within blots are relative to the densitometric analysis. Numbers indicate the normalized integrin a6 intensity ratio relative to the mean of normalized shCTRL samples. ( B ) Assessment of self-renewal capacity (mean ± SEM; n = 3; unpaired t -test) and sphere size (mean ± SEM; n = 3; Mann–Whitney test) in PN-GSCs silenced for ITGA6 . Micrographs from representative fields of gliomaspheres (scale bar = 100 µm). ( D ) Self-renewal capacity (mean ± SEM; n = 4; unpaired t -test) and sphere size (mean ± SEM; n = 4; Mann–Whitney test) in MES-GSCs silenced for ITGA6 . The number of independent experiments— n , the number of gliomaspheres scored for each condition—N. The values specified within the bar plot indicate the mean relative self-renewal capacity. ( E ) Transcript levels of ITGA6 and NES detected by means of qPCR in shITGA6 PN-GSCs and MES-GSCs (mean ± SEM; n = 3; unpaired t -test). ( F ) Relative transcript amount of ALDH1A3 , a specific MES stem cell marker, in shITGA6 MES-GSCs (mean ± SEM; n = 3; unpaired t -test). *** p < 0.001; **** p < 0.0001.

Article Snippet: Non-targeting shRNA construct (shCTRL; source clone ID: RHS4348) and shITGA6 plasmid mapping against ITGA6 exon 15 (target sequence: AGGATATTGCTTTAGAAAT; source clone ID: V3LHS_326014) were purchased from Thermo-Scientific.

Techniques: Western Blot, shRNA, MANN-WHITNEY, Marker